SERVING THE QUANTITATIVE FINANCE COMMUNITY

 
User avatar
tw
Topic Author
Posts: 892
Joined: May 10th, 2002, 3:30 pm

ATATTCATAATcATCTATATGA

September 20th, 2018, 9:23 pm

Hi

I am looking for advice and/or recommendations.

Has anyone out there had their (personal) genome sequenced?

We read that the cost of whole genome sequencing is plummeting but when I search around for providers their products seem confusing
and fraught with jurisdictional issues. I am less interested the data for diagnostic purposes but just want to get a copy of the ultimate personal information,
as in this example from http://genome.cse.ucsc.edu
>hg38_dna range=chr1:11185360-11185407 5'pad=0 3'pad=0 strand=+ repeatMasking=none
GAGCCCAGGAGTTCGAGACCAGCCCTGGCAACACAGTGAGACCCCCAT
Is this still a prohibitively expensive vanity product?

Gracias for any clues if anyone has looked into this.
 
User avatar
katastrofa
Posts: 6555
Joined: August 16th, 2007, 5:36 am
Location: Alpha Centauri

Re: ATATTCATAATcATCTATATGA

September 20th, 2018, 10:45 pm

It is relatively cheap and most services provide raw DNA data you're after (e.g. https://www.myheritage.com/help-center# ... -DNA-Test/ £59)

I don't know about the quality of those data, but since you're not interested in clinical diagnostics (in which case there are specific tests as most of diseases involves somatic mutations/acquired at any time of your life) they all should be fine. You can always upload your data to some online portals, which will identify your genetic risks and potential burdens to your offsprings.

Just bear in mind that you're trading your genetic privacy, which will certainly be monetised by the provider, with or without your consent,  e.g. 23andme sold their clients' data to Glaxo for $300 mil.
 
User avatar
Cuchulainn
Posts: 57288
Joined: July 16th, 2004, 7:38 am
Location: Amsterdam
Contact:

Re: ATATTCATAATcATCTATATGA

September 22nd, 2018, 1:24 pm

It's only a matter of time before it becomes mandatory, like a checkup when applying for medical insurance.
 
User avatar
katastrofa
Posts: 6555
Joined: August 16th, 2007, 5:36 am
Location: Alpha Centauri

Re: ATATTCATAATcATCTATATGA

September 22nd, 2018, 5:33 pm

 
User avatar
ISayMoo
Posts: 1117
Joined: September 30th, 2015, 8:30 pm

Re: ATATTCATAATcATCTATATGA

September 22nd, 2018, 5:52 pm

It's only a matter of time before it becomes mandatory, like a checkup when applying for medical insurance.
It's happening: https://9to5mac.com/2018/09/20/john-han ... ple-watch/
 
User avatar
ppauper
Posts: 69386
Joined: November 15th, 2001, 1:29 pm

Re: ATATTCATAATcATCTATATGA

September 22nd, 2018, 6:43 pm

there have been several recent news stories about bad people being caught by the cops because their relatives had uploaded DNA to such sites, and the cops had uploaded crime-scene DNA which got hits from those relatives, leading the cops to the bad guys
 
User avatar
katastrofa
Posts: 6555
Joined: August 16th, 2007, 5:36 am
Location: Alpha Centauri

Re: ATATTCATAATcATCTATATGA

September 22nd, 2018, 7:13 pm

Yeah, tw should definitely think twice.
 
User avatar
tw
Topic Author
Posts: 892
Joined: May 10th, 2002, 3:30 pm

Re: ATATTCATAATcATCTATATGA

September 23rd, 2018, 6:22 am

Thanks very much!

That seems very cheap.  Surely it can't be  whole genome sequencing (6x10^9 base pairs) at that price?

Dante labs seem to have whole genome sequencing for around 350 EUR with average 100x coverage
and with "Raw data available (VCF and BAM, free of charge)"  which looks quite cheap. But their are loads of companies offering a 
confusing array of jargon filled services.

Plenty to think about.

It is relatively cheap and most services provide raw DNA data you're after (e.g. https://www.myheritage.com/help-center# ... -DNA-Test/ £59)

I don't know about the quality of those data, but since you're not interested in clinical diagnostics (in which case there are specific tests as most of diseases involves somatic mutations/acquired at any time of your life) they all should be fine. You can always upload your data to some online portals, which will identify your genetic risks and potential burdens to your offsprings.

Just bear in mind that you're trading your genetic privacy, which will certainly be monetised by the provider, with or without your consent,  e.g. 23andme sold their clients' data to Glaxo for $300 mil.
 
User avatar
tw
Topic Author
Posts: 892
Joined: May 10th, 2002, 3:30 pm

Re: ATATTCATAATcATCTATATGA

September 23rd, 2018, 6:31 am

Yeah, tw should definitely think twice.
Indeed!

If I wanted to turn criminal late in life it might limit my options    ;)
I wonder if I could get the sequencing done under a false ID?
I guess medical insurance is the nasty one. It is not too hard to image a "pre-existing conditions" framework preventing insurers
from mandating tests (in some countries) but insurers scouring data from whatever sources are available to block or frustrate applications.

 
 
User avatar
Paul
Posts: 8727
Joined: July 20th, 2001, 3:28 pm

Re: ATATTCATAATcATCTATATGA

September 23rd, 2018, 7:11 am

The pre-existing condition thing is self limiting. Once it is known that a person is very likely to die from an expensive-to-treat illness then they won’t be able to afford insurance. And someone who doesn’t have any such issues won’t need it.
 
User avatar
Cuchulainn
Posts: 57288
Joined: July 16th, 2004, 7:38 am
Location: Amsterdam
Contact:

Re: ATATTCATAATcATCTATATGA

September 23rd, 2018, 9:38 am

It's only a matter of time before it becomes mandatory, like a checkup when applying for medical insurance.
It's happening: https://9to5mac.com/2018/09/20/john-han ... ple-watch/
In USA..
 
User avatar
katastrofa
Posts: 6555
Joined: August 16th, 2007, 5:36 am
Location: Alpha Centauri

Re: ATATTCATAATcATCTATATGA

September 23rd, 2018, 2:16 pm

Thanks very much!

That seems very cheap.  Surely it can't be  whole genome sequencing (6x10^9 base pairs) at that price?

Dante labs seem to have whole genome sequencing for around 350 EUR with average 100x coverage
and with "Raw data available (VCF and BAM, free of charge)"  which looks quite cheap. But their are loads of companies offering a 
confusing array of jargon filled services.

Plenty to think about.
Yes, sorry, that's definitely not the full genome for such a low price. As you probably already know, they offer different types of genotyping. They usually test your genome against some SNP array, which contains the most frequent variations in the human genome (SNP for single nucleotide polymorphism). The variations pertain to the currently known hereditary diseases, phenotypes, behaviours or include some variations of unknown functions. The full information would require sequencing the whole DNA, base after base. Again, sequences can mean identifying regions, just the exome (the part interpreted by RNA) or the whole genome (including the "junk"). The last would be probably quite expensive and I can't imagine how to perform an effective quality check (I'm not too knowledgeable about it, though).

Yeah, I'd definitely never test my DNA under my real name.
 
User avatar
Paul
Posts: 8727
Joined: July 20th, 2001, 3:28 pm

Re: ATATTCATAATcATCTATATGA

September 23rd, 2018, 3:06 pm

Every self-respecting criminal carries around a vial of someone else’s saliva just in case.
 
User avatar
katastrofa
Posts: 6555
Joined: August 16th, 2007, 5:36 am
Location: Alpha Centauri

Re: ATATTCATAATcATCTATATGA

September 23rd, 2018, 3:21 pm

Or a set of teeth.
ABOUT WILMOTT

PW by JB

Wilmott.com has been "Serving the Quantitative Finance Community" since 2001. Continued...


JOBS BOARD

JOBS BOARD

Looking for a quant job, risk, algo trading,...? Browse jobs here...


GZIP: On